Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E365086

Search information 
Request: 365086Match: SGN-E365086
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105247Clone name: cLPP-17-I17
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194783 [TUS-71-L13] Trace: SGN-T350454 EST: SGN-E549579 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365086Length: 605 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365086 [] (trimmed) TTCTCTTTCTCTCTCTCTCCCTCTCCTGCTCTTTCTTCTTCTTCTTTCTTCCCCTGGATCTTCAAACCCAACCCAATCTCTCCAAATCATAAAAA
ATCGAAACAATCCTTTAATTTCTGTGTTTCTTTAACACATTTTTCTCAAAATCTTTCTTTTTAACTTTTTTTTTTTTGGACTGATCTGGTTTAGA
AACGGGTCTGATTTGATCACATCGTGGGAGATTGATAAAAGGGGAAGATCCTTTCGTCATATAAAGAAGTGGGTACTTTTTTATAAGCTGTCCGT
TAGAGGGCTGTTGAATAAAATAGGAAAGAGTTACCCAGTGGTGCAGCGGCTGGAAGAAGTTTAGTACAGGGTTGATAGAAAATCCTTATTCTATA
TTACCTAGTCCTTCTTCACCTTCATTATACAACTTTTATTATCTGAGATTCCTTTCTTCTCTTCTTAAACCAATTCCTAAGTGGAAGTGCTTTGT
CTTATATATGCTTGTATTGCCTTGCACGTTTCCTTGAGGGCCTTCTGCCTATTTGTGCTTTAAGTTTCTTGTTTTTGGTGTTTAGCTACAAAATA
AGCAAATATGATGTTTTAGCTTGCCATTTTACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365086] SGN-U564984 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T176798 [Download] [View] Facility Assigned ID: TPOCM57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5