EST details — SGN-E365212

Search information 
Request: 365212Match: SGN-E365212
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105268Clone name: cLPP-17-J16
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194785 [TUS-71-L15] Trace: SGN-T348581 EST: SGN-E547706 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365212Length: 386 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365212 [] (trimmed) AACAGGGTTCTTTGGCCTACGTAGGTCCCGATTCATGGTTCGATTATGTCCTTATATCGGTGTCTGGTGAAGGATTCTGTTGAGGATTAAACATG
GAGAATGGTCATGAATCACTCAGCAATGGAAAACCAGCTGATCCTGGTCTCCAAATTATTAGGCACCCCTCTTACCAATCATCTTGTGGTAAATC
ATTGATATCTTGGTTAGATATAAGAGTTTTCTATATTAGAGTCAGCAATTTTATGGTAGATGATTCCACCCCGGAATATCTTACTCTCAACCACA
TTCCTCTAAGTCCCGATACATTGCTTGAAGTTAATGGATCAAGATGTTCCATGTATTCAGAAAGAGCATCTTGTCTCCTTCGAAGGGATAGGGTT
GATAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365212] SGN-U563603 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T176924 [Download] [View] Facility Assigned ID: TPOCP56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5