Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E365392

Search information 
Request: 365392Match: SGN-E365392
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110032Clone name: cLPT-2-C13
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365392Length: 396 bp (1007 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365392 [] (trimmed) ACATCTGCCCAAGCAATTCTTGACCTTATGGCTGTTGGAAAGGCAATTAAAAAAGTACCTGTTGTGGTGGGAAATTGTACTGGTTTTGCTGTCAA
TAGAACCTTCTTTCCCTACTCCCAGGGTGCACATATTCTGGTCAATCTAGGAGTGGATGTATTCAGGATTGACACGCAAATTGCCAGCTTTGGTC
TCCCTATGGGTCCCTTCCAGCTTCAGGATTTAACAGGATATGGAGTGGCTGTTGCTGTAAGGAAGGAATTTCGTTCTGCTTTTTCTGATCGCACT
TTTAAGTCTCCGTTGATCGACCTTCTAATAAAAAGTGGTAGAAATGGTAAAAACAACGGAAAAGGCTACTATATTTATGAGAAGGGAAGTAAGCC
AAGACCTGATTTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365392] SGN-U565753 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177998 [Download] [View] Facility Assigned ID: TPTAE19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5