EST details — SGN-E365790

Search information 
Request: 365790Match: SGN-E365790
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111347Clone name: cLPT-8-I15
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365790Length: 475 bp (847 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365790 [] (trimmed) GGAATTCGGCACGAGGCCAATATTTGTACAAATCTTCCTCATCTCCCTCGCACTCACACACACACACACACCTAGCAGGACTACTGTGAAGCCGG
CGGCAAAGGAAACTGAGAAAATGCCTGGGATTAAAGGGCCTTCCGATTATTCGCGAGAACCCCCTCGCCATCCTTCTCTTAAAGTTAATGCCAAG
GAACCCTTTAATGCTGAGCCAACTCGTTCAGCTCTGATTTCATCTTATGTCACTCCTGTTGATTTCTTTTACAAGAGAAACCACGGACCCATACC
AGTAGTCGATGACATAGAGAGGTATTCCGTTTCTCTGAGTGGTCTTATAAAAAATTCCAAAGACTTGTTTATGAAGGATATTTGTAAGCTTCCAA
AATATACGGTTACTGCCACTTTACAGTGTGCTGGTAACAGAAGAACTGCTATGAGTAAGAGTCGAACGGTGAAAGGAGTTGGTTGGGATATTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365790] SGN-U581608 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179289 [Download] [View] Facility Assigned ID: TPTBC56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5