EST details — SGN-E365796

Search information 
Request: 365796Match: SGN-E365796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111378Clone name: cLPT-8-K19
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365796Length: 444 bp (836 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365796 [] (trimmed) GAATTCGGCACGAGGGTTAGTTTTACGTTCTCTTCACAATTTCCATTACAGCCGCTAGGTTTCCGTCCACTTCTTCTTCTCCATTAATATCTGTC
TGGTGTTCTTCTTTTTTGAATTCTAGATTTTGGCTTTGAATTCTTGTGAATTATTTATTTTCTTTGTTTAAATCAAGAAATTAGCTTCTTCTGAA
GTCAGGGTGGGGATTTTTGGATCGTGTAAAAGTGTGTTAGAGGGTGATTATCTTTTGATTCACTTGTTTTTTTGCTTCTTTTGAGGGGGTAGCCG
GGGCCTCGGCCTCGGCGGGTTTTAATAGCCCCCAACTATTACAACATTGGGAAGAAGAACATCAATCTGTACAAACCCTTAAGTTAGTTTTTCTT
TTTTATTCTTTGATTCTTTCTTCTTAACAAATCAAAACAGATCGGGGAAGAGATGCCGGCCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365796] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179295 [Download] [View] Facility Assigned ID: TPTBC70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0083 Quality Trim Threshold: 20.5