EST details — SGN-E365833

Search information 
Request: 365833Match: SGN-E365833
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111406Clone name: cLPT-8-M2
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365833Length: 279 bp (858 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365833 [] (trimmed) GGATCCCCCGGGCTGCAGGCTAGTCTCGAGTTTTTTTTTTTTTTTTTTCTAAAAACACGCCAATAATCTCCGAATTATTCAAGAAATTAAAAACA
AAATACAGTAACCAAAAAAAAAGAAAAAAAAAGAAAAAAACACAAATTAAATATAATATCTAATAATTTTACCCTAAGGTAAAGTAATAAATTCT
GCTAAAGTCACAGTTAAAACGAGTGAAACGGCTGACACAAGTACAACTGATGGAGTAAATGCCTTCACTGCAAATGAATTTGGGTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365833] SGN-U578700 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179332 [Download] [View] Facility Assigned ID: TPTBD73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5