EST details — SGN-E366344

Search information 
Request: 366344Match: SGN-E366344
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C109883Clone name: cLPT-1-G21
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C109883 [cLPT-1-G21] Trace: SGN-T177768 EST: SGN-E366343 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366344Length: 609 bp (920 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E366344 [] (trimmed) TTTTTTTTTTTTTAGTAAAGAAACAAATATCATTAATGTAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAACAAAAAGAAGG
AAAACAAGGGAAAATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTTTA
GAACTTAGTATCCTTGGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGG
TAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCACCCAAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATC
GTAGTATCCTGGTGACTTGTTGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACT
CAATTTCGCTGAGCAATTGCTCGTCGGACAAATCAGGAAGGTACGATAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAT
CTGACTCTTCCACCATTGCTAGCAATGGAGGTGATGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366344] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177769 [Download] [View] Facility Assigned ID: TPTAA47TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5