EST details — SGN-E366768

Search information 
Request: 366768Match: SGN-E366768
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110826Clone name: cLPT-6-G1
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C110826 [cLPT-6-G1] Trace: SGN-T178624 EST: SGN-E366769 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366768Length: 597 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E366768 [] (trimmed) CCTCTCCCGCCGGCAATCCAGTTGTACCAGTTTCTCTCTCTACTTTCTCTCTCTATATATTATATATATAGTTTCTCTCTCTACTCTCTCTCTAT
ATGTAATGATTTATTGATTTTGCTTTGAGTTTTTTCAAGAAATGAACTTTGAATGCAGGATATAGCAAGTTTTGATTGATGGGTGTGATTGAATT
ATGCAACATTTCATCTATTAGCATTGTTAGAGCAAAACCCAGTTCTTTAAACGAAGGGAATCGGAGGAGGAGAATTGCTTGTATGGCCTCTTCAG
TGTCAGTGCAAGAAGAGGAGAGCCATCAGCAGAAACAAGGTGTAAATGGGGTTTCTTTTATTCGGACCCATCTTCTTAAATTGTCCCCTTATCAA
CCCATTTTGCCATTTGAGGTCTTGTCCACTCGTCTTGGTAGAAAGCCAGAGGACATTGTGAAATTAGACGCTAACGAAAACCCCTATGGACCTCC
TCCAGAGGTAAACGAAGCTTTGGGGTCTATGAAATTTCCATACATTTATCCTGATCCTGAAAGCCGCACGCTGCGTGCAGCTCTTGCTGAAGATT
CTGGCCTTGAATCTGAGTATATTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366768] SGN-U574459 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178623 [Download] [View] Facility Assigned ID: TPTAU37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5