EST details — SGN-E366901

Search information 
Request: 366901Match: SGN-E366901
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110795Clone name: cLPT-6-E15
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C110795 [cLPT-6-E15] Trace: SGN-T178755 EST: SGN-E366900 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366901Length: 441 bp (989 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E366901 [] (trimmed) TTTTCCTTTAACAAGGGGAAATAATATAGGACTAGTATACAACAGTTCAATATTTACACTTTTGAAGATCTATCAACATAAATAAACACAACAGG
ACTCTTCAAGCTGCTGTTTAGCTCATTGCATTATGAGCACAAGGGTTGTGATGTCCTATAAGGGCAGCATGCCCTGATAGAGATACAACATGTAT
ATATATACTACAATTATAAGGTTTCCATCACAAAACTATTGTTCATCACTCGCGTTTATGGAATTTAACCGCCTTAGTCTATGGTCAAGCTCTGC
CATGACCGATGGTTCCTGCTTTTTCCTCTGTCTTGATATAGTAGAGGTTGTCATAAAACCAATTTGATCAAAAGCAACCCGCAACAAGTCATCAG
GATCAAAAAGTTGATGTGTGCATCTCTGGATTATATGAATTACATCCCCAACATGATGCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366901] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178756 [Download] [View] Facility Assigned ID: TPTAU32TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0178 Quality Trim Threshold: 14.5