EST details — SGN-E366930

Search information 
Request: 366930Match: SGN-E366930
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110917Clone name: cLPT-6-M15
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C110917 [cLPT-6-M15] Trace: SGN-T178784 EST: SGN-E366929 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366930Length: 452 bp (896 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E366930 [] (trimmed) TTTTCTGGGCGCAAAAAGCTTCAAAGTTTGTGGAGAAAAGGAATGGGGATTTTCGAGCCTTTTAGAGCAATTGGATACATTACAACCAATGTTCC
TTTCTCTGTACAGAGACTTGGTACTGAAACCTTCGTCACCGTCAGTGTCGGCAAAGCTTTTCAAGTTTACAACTGCGCTAAACTCAGTTTGGTTC
TCGTTGGCCCACAATTGCCAAAGAAGATTAGAGCTCTTGCTTCTTATCGTGAATATACTTTTGCTGCCTATGGGAGTGACATTGCAGTTGTCAAG
CGTGCTCATCAGGTGGCAACATGGAGTGGACATAGTGCTAAGGTGAACCAATTGCTTATTTTTGGTGAACACGTCCTAAGTGTTGATGTTGAAGG
CAATATCTTCATATGGCAATTTAAAGGTATAGACAAAAATCTTGCTCCGATCGGACACATAAAGTTAGAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366930] SGN-U571654 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178785 [Download] [View] Facility Assigned ID: TPTAU80TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0070 Quality Trim Threshold: 20.5