EST details — SGN-E367140

Search information 
Request: 367140Match: SGN-E367140
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110651Clone name: cLPT-5-L5
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: Alias clone SGN-C183045 is on microarray TOM1: SGN-S1-1-6.3.3.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367140Length: 569 bp (998 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367140 [] (trimmed) CGATTTACTAATGATGAGTCCAAGTCTGATGAATCCCGTCTCTCTGGTAGAAAATCATCCATCGTGCAGGAGGAATAGGGATGGACATAAGATAC
TACCTAATGGCCAGAGCTGGAGGCCTCAATTACTACTATTAAGCTACTCAATGAAGATCTTATCTGAAGCAAGTGCACTTTCAAAGCCTGAAGAT
CCATTTGATCACCGTAAGCTCTTTGGTTTCCGCACACGCTCACCACCTCTTCCCTACATGCTTTCTTCAATGTTGCAGTCACGTGCGCATCCAAA
GCTTTCTGCTGAGCAGGGTGGTGACAACGGTGATTCAGACATTGACTTAGATGATTTGTCAGACTCTGACCAAGAAGAAGAAGATGAGTATGACC
AGCTTCCTCCCTTCAAGCCTCTTCGGAAGGCTCAGCTTGCTAAGCTCAGCAAAGAACAGAGGAAGGCGTACTTTGAGGAGTATGACTATAGGGTC
AAGCTCCTTCAGAAGAAACAGTTGAGAGAAGAGTTAAAAAGAATGAAAGAGATGAAAAGTAAGGGAAAAGAGGCTGCAATTGACAATGGTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367140] SGN-U571197 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178409 [Download] [View] Facility Assigned ID: TPTAS63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5