EST details — SGN-E367533

Search information 
Request: 367533Match: SGN-E367533
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110986Clone name: cLPT-7-B17
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: Alias clone SGN-C186193 is on microarray TOM1: SGN-S1-1-2.2.5.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367533Length: 343 bp (1041 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367533 [] (trimmed) ATGGACAGAAGATAACATGCCCAGGCGAGGCTGATGAATCACCTGATACCGGCACTGGGGACATAGTTTTTGTCTTGCAACAGAAGGAACATCCC
AAGTTTAAGCGGAAGGGAGATGATCTCTTTGTAGAGCACACCTTGAGCTTAACCGAGGCCCTGTGTGGTTCAGTTCATCTTGACTCACCTAGATA
CCAGGCAGCTGATCATAAGTCCCAACCCGGAGAAGTTGTCAAACCTGATCAATTTAAGGCCATAAATGATGAAGGAATGCCTATGTACCAAAGAC
CATTTATGAGAGGAAAACTATGCATTCACTTCACTGTAGAATTCCCCGACACGTTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367533] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179095 [Download] [View] Facility Assigned ID: TPTBA09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0143 Quality Trim Threshold: 14.5