EST details — SGN-E367561

Search information 
Request: 367561Match: SGN-E367561
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111228Clone name: cLPT-7-P15
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367561Length: 432 bp (1068 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367561 [] (trimmed) AATCATAGTGAACTTATAAAGGCCGTGAAAATGAGTTCAGAAATAATGCTATTGAGCTACTTAGGCGTTTTCAGAATGATGTCGGTGAGCTTGCA
ACTGAGGAGAACAAGAATTTCAGGGATAGGAACGTCTTCATAGTTTTGGTACCGAATAAGGCTATTGTACAGAAAGCTCCAGAGCAACCGAAGAA
AAAGGAAAAACCAGCAACTGAAGTTTCAGCCAGTGTTTGAGCATCAAATGAAAGTTTATTATAAGGGGGTTATTAGCAGATAATTCAATGCATAT
AATTCTCAAGAGAAAGGTGAGAGATGCACCCTGATATCTGTCTTGTATAGAATTTAGTCACATACAAGCCTGTAATAGGATGTACACTTGTGTAG
TGTCTATATAACAGTAGCAAGAAACATTCAGTTTTTGTAGCAACATATAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367561] SGN-U584629 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179123 [Download] [View] Facility Assigned ID: TPTBA92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0108 Quality Trim Threshold: 12.5