EST details — SGN-E368009

Search information 
Request: 368009Match: SGN-E368009
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175811Clone name: TUS-22-F1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175811 is on microarray TOM1 spot ID 1-1-8.2.11.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16839 [cLED-17-L8] Trace: SGN-T53053 EST: SGN-E238611 Direction: 5' Facility: TIGR
Clone: SGN-C175811 [TUS-22-F1] Trace: SGN-T1378 EST: SGN-E378516 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175811 [TUS-22-F1] Trace: SGN-T180757 EST: SGN-E368008 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368009Length: 655 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368009 [] (trimmed) TGGTGTTGCAGCTCCAGGACATGATGTACGATTACATCATGATCCACAATCAAAGAATTATGTTTTCTCAAATGCTCTTTCAAGCCCTGTTCGGC
AAAGCCTGCAGAATTATCAAGTTGCTCAAGGAGGTTACTTTTCAAACAATGTTCAGCTATCAATTGGAGCAAGAAACAACGAAACCAACCTCCAC
CACCAAAATGGGGATTCCAATAGCTATAACTCAGCTGATGCTGCCATGGATATGCATTCTGATAGCCCTGGTCATGATTTTACTTGCTGAAGTAA
TTTGTATATAGAATGTTTTGGGAGCTGCTTCTTGTCATGCCGTGGTATTCAAGCAGCAAGTTCAGGTTGATTGATTGTCGTGTGTAGCAGCTGTT
GTCAGGGAGAAAATGCCGTTATTGAATTGGGTGTATGATTCAGAGATTGAAAGGTGCGTTCGTGTTGGCTAGTAAATCATCATTCTGTTGACATG
CTCTTAACGTAAAATGCAACGTGATGGGCACAATACTTGCTGAATATACTGTTGTTTCTGTTGAACTAGTTAGTTCTTTTCGGTCTTCTATGATG
TTTATGGAGTATTATTTTAGTTAGGTATAAATATATATAGATATATAAATGTGCTCATCTGTTGCGACTTGTGACGTTCGATTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368009] SGN-U570653 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180758 [Download][View] Facility Assigned ID: FA0AAD10CC01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0113 Quality Trim Threshold: 12.5