EST details — SGN-E368160

Search information 
Request: 368160Match: SGN-E368160
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175894Clone name: TUS-22-I12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175894 is on microarray TOM1 spot ID 1-1-5.1.11.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17317 [cLED-19-E6] Trace: SGN-T53404 EST: SGN-E237490 Direction: 5' Facility: TIGR
Clone: SGN-C175894 [TUS-22-I12] Trace: SGN-T180638 EST: SGN-E368159 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368160Length: 636 bp (929 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368160 [] (trimmed) CTTTTGTTTACTGGTTCATCATTTTTCTAGAAAGCTCGATAGTAGTATATTATTGCCTGCACTTGCCACTAAAATCTAGTTTTGGTATCTATCTT
TGTTTTTGGAACTTTTGGGATATGAATTATTATTATGCTGTTTCAGCTCTGAGTTTGTCATAGTTCCTTTGTTGTTTCATATTGCAAGAGCTTTC
TGTTGAGATAGAGCTAGTTTCACCTTTCTAACTGGTGTAGGCCTTGTAACAATCGTCTAGAATGATGGATTAACAATTTTGTCCTTTTGAGTTAA
TAACATTTGAATCAGCACAAATGATGGATTTGAATCTCCAGTTCTACAAGAAATGCAAATCCTCCTTAAGAGTGAGAAAAAGGAAATTTGTGTAC
ACCTCTCAGTTTCGCAATAATTTTATTTTCATAACATGTGTATATATGTGAGAGACAATAAATCATATGAATATTGGACAACTATTGAGCTTGCT
GTTCACCATGTTTGTTTCTCCTGTTTCCTCCTCTTCAGTTCTCTCATCATGAACCAGGTGTCACTCATGTGTTAGTCACTGGAGGTGCTGGATAT
ATTGGATCGCATGCAGCATTACGTCTTCTAAAAGATTCTTACCGAGTGACCATAGTGGACAACCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368160] SGN-U573012 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180639 [Download][View] Facility Assigned ID: FA0AAD10BE06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5