Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E370621

Search information 
Request: 370621Match: SGN-E370621
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177674Clone name: TUS-27-C16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177674 is on microarray TOM1 spot ID 1-1-1.3.6.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47496 [cLEI-16-G8] Trace: SGN-T83220 EST: SGN-E268996 Direction: 5' Facility: TIGR
Clone: SGN-C177674 [TUS-27-C16] Trace: SGN-T182995 EST: SGN-E370620 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370621Length: 659 bp (922 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370621 [] (trimmed) GGAGAGGGGTGCTAATGTGAAGAATGAGACTAGACCTAAGAACAGATAAAGAAGCAGATGGGCAATTGTGGTACTAGAGAAGAATCTGCTGTTGT
CTCCAATGCTCATCATCAAGTCCAGCAGCAGCAGGGGTTATCGTTGGGAAGCAGGATAGGTATTGATTCAAAGAAACATAGTCATAGTCGTTCTA
CATCAGATCTGAGTGATCCTTCGACTCCGAGAAACTTAGAGGATTTTAGAAAGAATGCTGTACTGTATACTCATATAATTGCATTTACTCTTTTT
GAGCTGGAGACAATTACTAAAAGCTTCCGATCTGATTATATACTTGGTGAGGGTGGTTTTGGAACTGTTTACAAGGGCTACATTGATGAGAATGT
TCGTGTTGGACTTAAGTCTTTGCCGGTTGCTGTCAAAGTACTTAACAAAGAGGGGCTTCAAGGTCACCGTGAGTGGCTTACTGAGGTCAACTTTC
TTGGACAGCTTAGGCATTCTAATCTTGTCAAGTTGATCGGGTATTGCTGTGAGGATGACCATCGTTTGCTCGTTTATGAGTTCATGTTTAGAGGA
AGCCTTGAGAATCATCTCTTCCGAAGGGCTACTGTGTCATTATCTTGGGCTACAAGATTGATGATTGCTCTTGGAGCAGCTAAAGGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370621] SGN-U578571 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182996 [Download][View] Facility Assigned ID: FA0AAD15BB08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5