EST details — SGN-E370631

Search information 
Request: 370631Match: SGN-E370631
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177724Clone name: TUS-27-E18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177724 is on microarray TOM1 spot ID 1-1-7.1.6.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C61995 [cLEM-1-C13] Trace: SGN-T83704 EST: SGN-E270331 Direction: 5' Facility: TIGR
Clone: SGN-C177724 [TUS-27-E18] Trace: SGN-T1460 EST: SGN-E378274 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177724 [TUS-27-E18] Trace: SGN-T183005 EST: SGN-E370630 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370631Length: 697 bp (938 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370631 [] (trimmed) AATTTCGACTGAGAAAGCAGTATACACAAAGAGAAGAGAAGAGGAACGACAACAAATACATCGAAGAAAATATATGGGATCGACTGATTCAGAAT
TGGATTCAGTTTTTCAGGATAACAAGCGTAATCGTAATCGTCTTAGTTCCGATCGGAGGCTCAGCCGGTACGATGTGGTAAATCCGCAGTCTCAT
CTGCAAGAACAGCCCAACGCAATGTAATACCATGGCTCTACCACAAGGCATTAAGCTTACAATTGAACGCAACAACTCTTTTTCAAGTTTCCTCG
TTCATTTGCTCCCCACCTTACTAAGTTTGCTTTCAGTTTTCAAGTTTTACCCTTTAGGCATGTTTTGAACATTATATAGGACTTGTTTCAAGGTA
CAGGATGTTACAGATTACTCTAGGCGTATATGTCAATGATGGTAATTCAGCCTCGTTAATTGGATCAATAGCTGTTATTAACTTATGCTATATAT
ATAACTTTATAGGTTGGGCTTGAGCTTAAATGTGATAACCAACTTCTCCTATTTCCAGAGAAAGCAATAATGCAACTTTGCAAAACCTTGTCTGA
TTAACTGTATGGAGTGTTCGTATATGTTTATGATTATAAGGCGAGGTCATTTGGTCTTCTGTTATGAATTCTTGAGAAGTGATGCATTTTCTGCT
GCCTTACTTTCCTGTGAGATATCGTTCATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370631] SGN-U562629 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183006 [Download][View] Facility Assigned ID: FA0AAD15BC09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0212 Quality Trim Threshold: 14.5