Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E370711

Search information 
Request: 370711Match: SGN-E370711
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178138Clone name: TUS-28-F24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178138 is on microarray TOM1 spot ID 1-1-1.2.4.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64608 [cLEM-6-K18] Trace: SGN-T84443 EST: SGN-E270687 Direction: 5' Facility: TIGR
Clone: SGN-C178138 [TUS-28-F24] Trace: SGN-T183642 EST: SGN-E370710 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370711Length: 594 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370711 [] (trimmed) AAACGGTACTAACCTTTGAATATACAGAGAATTAGAGTTTTCATCATTTTTCGGTGGTAATCCAACTAGCTGTCTATGTGATACTCACAGAATAA
AATTGGCAACTTTACATATACAGTACCAACACTAAAAAAGTTAAGGAAGAAAAATATGAATAGATTTTCAACATGCTCAGCTAAAATGAGATTAG
TACTATGTCCACGAAACCTGTCAACAGAACAGAATTTGCAATGTCAGAGCACAGATTCAAAATTGTATCTAACCTGAAAATCATTAACATGTCCT
TGACCAGCACTCCTTCCATTTTCCCTCTCATAATCAGCATTATCCGTGGGCAACTCGTGGCGACAAACAGGACATGTATTACGGATATTTAGCCA
TGGCATAATACAATCACAATGGTAGTAGTGAGAACAGGGCAACCTAGTCATTTTCTTCGTTGACAAAATCTCATCTTTGCAAACTGCACAAGCTG
CATTGCTTCCTTTCAAATGTTCATCACTCACGACCACCAAAGGAAGATTTTCCAGCACAGATTTAGCTGTTGGTGGACTACCCTTTAACCTCTCT
TGGCTTTCAACAAAATCAACAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370711] SGN-U566164 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183643 [Download][View] Facility Assigned ID: FA0AAD16DC12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5