EST details — SGN-E371122

Search information 
Request: 371122Match: SGN-E371122
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178125Clone name: TUS-28-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178125 is on microarray TOM1 spot ID 1-1-6.2.4.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64587 [cLEM-6-J13] Trace: SGN-T84474 EST: SGN-E270718 Direction: 5' Facility: TIGR
Clone: SGN-C178125 [TUS-28-F11] Trace: SGN-T183483 EST: SGN-E371123 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371122Length: 734 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371122 [] (trimmed) AACAGTTAAAACAAACGTTATATTAAAACTAAACAGAAAAACAGAATACAATAGGTAATAACAACCATCCAAACAAGCTGTTAAAATGTCAAGTA
CTTGTCATAAGCTAAACTTCTCACTTGCTTTGTACATACTCCAACAGGATTCTCATACAACTCTATCCATCTCCTCTTTCCAATATACTTCTATA
TCTATTTTTTCATTCTTCTTTCTCCTTCAGCTGGTTTTCTGTTTTAATGCATAATTATTCAGTAGTTTTCGAGTTGTTTTGTTTTCTTCTCATTA
ATTTCTCTACAGCTTAGAAACTTGTATCCTTTTCTCCATCAATGTTTACTGTCTTATCAAATGTAATACATCATTGAACACACAAGAAAGCATCT
GAATCAATAGAAAGAACAGTTATCATGCCTTTTGGTTTGGTGTCAGCGTGGAACAAACGTAGGAGAAGCAAGTCTGAGGATATGCTAAATCCTTG
TATGTTTCCAGCCTCTTCATTATCCTTCATCTTCTTAATAGAGCAGCAATGTTTATCACGCTATTGTGATTGCCTGTGCTGCATCATATTACTTC
ACAGAGTTGCATATAGCTTCTGCATGTTATAAAGTTCAACATGATTGTTTTCAGGGATATATAAACCTGTAGAATATTGGCAAATCGAAGACCAG
AATCCACCTCAAAACTTGTCTATGTTTACATGTTCACGTGTCTACTGAAGAAGTGCATTCATCAACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371122] SGN-U575582 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183482 [Download][View] Facility Assigned ID: FA0AAD16CC06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5