EST details — SGN-E371329

Search information 
Request: 371329Match: SGN-E371329
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177625Clone name: TUS-27-A15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177625 is on microarray TOM1 spot ID 1-1-2.1.6.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46709 [cLEI-13-H13] Trace: SGN-T82469 EST: SGN-E268408 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371329Length: 739 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E371329 [] (trimmed) TAAGACTAGACCCCTATGAAGTGCCGGCTGCCACGAGGGATTCCCCGGATCACGAGATTAACACTGCTTATAGAAAGCTCGCTCTCATGTATCAT
CCTGACCAGAATGCTAACAAGTCCTGACGCTTCAGAACATTTCAAGGAGGTTGCATACTCATATAGCATTCTATCTGATCCAGAGAAAAGGAGGC
AATATCATATGGCTGGCTTCTAGGCTCTTGAAGCTGAACGAATGGATATGGAAATTGATTTGTCCAACCTCGGAACTGTCAACACAATGTTTGCA
GCATTGTTTATCAAGTTGGGTGTTCCTATCAAAACACCTATCTCTGCGAATGTTCTTGAATAAGCTTAGAATGCAACTGTCACGGTCCGCCCTCT
TCCAATTGGTACCTCAATCACTGTAAAGGTAAACAAGCACTATGCTCATTTTTTCCGAGTAACAATTAATGACGAACAAGCACAACCACGGATTG
CATTAAGATCTACTTCAGCTGCCCAAAGCAAATTCAAGCTACTATATTTTGAACATGATGTGAGTGGCGGTTACGGCCTGGCCTTGCAGGAAGAT
ACTGAAAACGCAGGCAAAGTAACCTCCGCAAGAATGTATTTCTTGCACTCTCAAGTGCACAGAATGGATTCAACTGTAAATGCGTTAGCAATGGC
CAAAGATCCTGAAGCTGCTTTCTTTAAGAGGCTGGAGGGTCTTCACCTTGTGAGGTCTACAACTAAATGCCCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371329] SGN-U574490 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182837 [Download][View] Facility Assigned ID: FA0AAD15AA08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0227 Quality Trim Threshold: 14.5