EST details — SGN-E371605

Search information 
Request: 371605Match: SGN-E371605
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178632Clone name: TUS-29-K14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178632 is on microarray TOM1 spot ID 1-1-3.3.4.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72299 [cLER-1-M15] Trace: SGN-T92071 EST: SGN-E280517 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371605Length: 527 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E371605 [] (trimmed) TTGTTACTTCAGCTGGGACTTGTTTAGGGTGCTTGCTTGTAGCACTGGGGTTTCTTTTCAAGGGTTATCATTCATCAGCAGAGCTAACTTCTTCA
ATGGTGTACACTGGCATACTGCTCTTTTCTGTATCTTTCACAGTGGGAATGGGAGGTACACCCTGGATCATCATGTCAGAGATACTTCCGATAAA
CATCAAGGGTTCTGCAGGAAGTCTTACGGCATTGATCAACTGTTTTACTTCTTGGATAGTTTCTTATGCTTTTAATTTCCTATTCGAGTGGAATG
CAGCAGGAACATTCTTCTTGTTTGCATTCTTTTGTGGCTCGGTTGTTGTATTCGTTGCAATGCTGGTACCAGAGACCAAAGGAAGGACACTTGAA
GAAATCCAGGCATCGATGACATTACTCCAATGATATCATATGTTCTTTAACCTTCATTCCCATTTTGAACTTCATAGTTCAGACTACTTTATCAT
TCAGAACTGAAACACACGTGTATTGTGATTATATTGATGTTTGTTACGTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371605] SGN-U584595 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183934 [Download][View] Facility Assigned ID: FA0AAD17BF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0015 Quality Trim Threshold: 12.5