EST details — SGN-E371819

Search information 
Request: 371819Match: SGN-E371819
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178909Clone name: TUS-30-G3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178909 is on microarray TOM1 spot ID 1-1-6.3.3.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71401 [cLER-17-M1] Trace: SGN-T95973 EST: SGN-E283122 Direction: 5' Facility: TIGR
Clone: SGN-C178909 [TUS-30-G3] Trace: SGN-T184434 EST: SGN-E371820 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371819Length: 739 bp (918 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371819 [] (trimmed) GGTTAAAGAGAATTCATATATTTCATTCATGCAAAAGAGCCCTTCTACTTGTTATCAAACATATCCACCAAAGCTATCCTTCATTTTCATCATGA
TTTCTATAGAGAACTTCTCATTTTTCTTCACTTCATATCTTTCCAAAACTAATGGTATAAGTCATTTTCCACCTATACACCATTACTAGCTACTT
CCTACACCCACCCCCAACAAAAGCCCTCAAAATGTTGCAAAAGCTATTGTGATAGATAAAGCTTTCTGCATAGCTGAAATGGAACCATAATCTTG
ACGCCCGTCTTCTATGGCTACATGATTTCTGGTAAAGATTGCTTCAACTCCTGCTGTTATTCATGTTTAGAACAGAATCCTGTCTTGGTAAATGT
CCAAGGCCTGTATAACCTTCTCTATCAGTAATTTCCGATGTAATCTATACTTTATTGCTGCTTCGAATGTTCTCCTGCATTCAGGCATCGAATCT
AGGATTTTCTGGTCTTCGTCAGAAGTTGTGGGAAATTCTGCAAGCATCTGGTGGCATTCTTCTTGCAGCTCCTTCACTGCTTTCCTCTCTAGACT
TGGAATTGGAGGGAGATCTCCATCTGACCAAGTGGGCAACGTTCTTGCGGCTGCTATTATTGCTCCATCGACGAATCTGTCTCCATCATTTGATA
GCTTACCTGTGTTGTGGTAATATTCTCCAGGGAGGCCAGATATGTTAAAGACCGATAAAAAGGTGTCTAGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371819] SGN-U584726 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184433 [Download][View] Facility Assigned ID: FA0AAD18AD02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0015 Quality Trim Threshold: 12.5