EST details — SGN-E372205

Search information 
Request: 372205Match: SGN-E372205
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178793Clone name: TUS-30-B7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178793 is on microarray TOM1 spot ID 1-1-2.2.3.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70706 [cLER-15-K18] Trace: SGN-T95181 EST: SGN-E282661 Direction: 5' Facility: TIGR
Clone: SGN-C178793 [TUS-30-B7] Trace: SGN-T184646 EST: SGN-E372206 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372205Length: 439 bp (918 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372205 [] (trimmed) AGAACATAAATAATAATTACGTATATTAAATGGTCTAAACAAAAACCCATACACCAAGAATGTAACACTAGACAAAAATTATAAAATAAAGTGAA
ACAAATAAAAATACATGTAAACTCCAACACATGAATACAAATAAGTGTTTTTAAGCAATCATCAAAGAAGCACAAAGTAATAGTAAAATTGACAT
TCCACTCCATGTAAATTTGTTTACTCCATTGTTGCCATTGTTTCCTCCTGGTGTGACTGGGGGTGGCAAGCCTTCAGAACTTGGACCTGGAGCAC
CACCTGAAGTACAAGCACTGAGATCACCAGGAATATTACAAGCCCTAGGAAGTGCAAGTGCTTGAGTAATATTAATACCAAGTGAAGGCAATAAA
GTTGGATTTTCATATAATTTACACAAACAATCTAAGTCATTTGTTATTGCTTCTCTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372205] SGN-U575965 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184645 [Download][View] Facility Assigned ID: FA0AAD18CA04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5