EST details — SGN-E372635

Search information 
Request: 372635Match: SGN-E372635
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179161Clone name: TUS-31-A15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179161 is on microarray TOM1 spot ID 1-1-2.1.2.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76543 [cLES-18-F22] Trace: SGN-T101776 EST: SGN-E289334 Direction: 5' Facility: TIGR
Clone: SGN-C179161 [TUS-31-A15] Trace: SGN-T185091 EST: SGN-E372634 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372635Length: 704 bp (905 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E372635 [] (trimmed) TCAACGCTGCACTTAATGACGAGCTTTTCTTCAGTATTGCAAATCATACTCTCCAAATTATCGATGCTGACGGAGTTTACGTTAAACCATTTGAG
ACAAATACACTTATTATTACACCAGGACAAACACATAACGTTCTTCTCAAAACTAAATCTCATTTCCCTAATGCAACATTTTACATGACTGCTCG
ACCTTATGTGACAGGTCCTGGTACATTCGATAACTCTACAGTTGCTGGAATATTAGAGTACGAATCCGAAACAAAACTCTATTTGAAAAATCTAC
CGCTCTTTAAACCGTTACTACCAGCTCTGAATGACACAAATTTTGTCACCAATTTTACTAATAGATTAAGAAGTCTGGCGAGTCCTCAATACCCT
GCTAATGTACCTCAAAACGTCGATAGACGTTTGTTTTTCACAGTAGGTCTTGGAACAAGCCCTTGTGATAAAAACAAAACATGTCAAGGACCTAA
TGGTACAAAATTCTCAGCTTCAATCAACAATGTGTCATTTGTGTTACCTACAACTGCTCTTCTTCAATCTCATTTCTTTGGTCAATCTAAAGGTG
TATACAAACCTGATTTTCCTTATAGTCCTTTAAATTGGTTTAATTACACTGGGAACCCTCCAAATAACACTCTTGTTGCAAATGACACAAAACTT
ATGGTTTTACCATTCAACACAAGTGTGGAGTTAGTAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372635] SGN-U564413 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185092 [Download][View] Facility Assigned ID: FA0AAD19AA08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5