EST details — SGN-E372655

Search information 
Request: 372655Match: SGN-E372655
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179257Clone name: TUS-31-E15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179257 is on microarray TOM1 spot ID 1-1-2.1.2.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77183 [cLES-20-D18] Trace: SGN-T102293 EST: SGN-E290614 Direction: 5' Facility: TIGR
Clone: SGN-C179257 [TUS-31-E15] Trace: SGN-T185113 EST: SGN-E372656 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372655Length: 702 bp (911 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372655 [] (trimmed) GAAACGAAAGGTGTCTTCTACTTATCACGGGCAGCTACCCATAGTTACCTTTTAGGCGAGATGATAAATGTAAATATTTATTTACACAATCAGTA
TCAGTTTAAAGAAGTTAAACTCTTACATAAATATGTAGCAATAAGACTAATAAACATAAATTATACATCAAGCTTTTTGCAAAGCTTAAGCATAC
AAAATTCAGTCAGTATCTTCACTGAAATCAGGTTCTGGAGGTTTTTGCAGCTTCATAAGCTCCCTAGCAGACTTGAGATTTCGATTCTTATGAAC
GCCTCGGAGAGCATTAGCTGCAAATCTCGATGCCAAGAACGTTGCCCCAATACTAAAAGAAGCTCCACCCGAGTTACTACTGGCCCCGGCCAACG
CTTCTGCTTCTTCATCCTCTTTTCTTTGTAGTTCCATAAGTTTCCTTTTCGTGAAACGCCTCCATGCTGCTTGGATGAAGCAAGCAGCCCAAGTT
CTCCAGTGCTGTGAGTAGAAACGGAACGTGTGCTGTACCTGTCTACTGTGGAGCTTTCTGAACTGACTGGCGACGAATTTCAACTCATCTGCTAT
TAATGCAAAAGCCTCTACCTCTGTCAGAGCTTTCACGGTACGAGTAGAAGATGGGAGGTTAGAACCTGATTTCGGGTCTAGTGCCCAAGTAAGAA
GTTCTTCTCCACAGAAGTCGGATTCTTTTAACAAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372655] SGN-U571286 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185112 [Download][View] Facility Assigned ID: FA0AAD19AC08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5