EST details — SGN-E372779

Search information 
Request: 372779Match: SGN-E372779
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179818Clone name: TUS-32-L24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179818 is on microarray TOM1 spot ID 1-1-1.4.1.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80896 [cLET-13-L15] Trace: SGN-T105983 EST: SGN-E294140 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372779Length: 669 bp (880 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E372779 [] (trimmed) TTCTTTCTCAAAATTTTCTAAATTACAATAGTTCACCGTCGATCCTTTCTCGGTCAATTTTATATTCTGGTGACGATGTCGACGGCGAGAGCCGG
TAATGACGATAGTTCTAATGGTGTAGATACGACTCCGTTGCTTACCGATCAGGTTTTTAGGAGCCGACGGTTGGCGCGCCGGGCCCCGACCCTAA
GAGGAGCGGCTCGATTTCTCCGGCGAGCAAGTAACCACCGACTGATGCGGGAGCCGTCAAGGCGCGTGAGGGAAGCTGCAGCTGAGCACATAGAG
GAACGACAAAGCGATTGGGCATATTCCAAACCTATAGTGATATTGGATCTTATCTGGAACTTAGCTTTTGTGATTGTCTCAGTTTCTGTGTTGAT
TCTGAGCCATGATGAGTTACCTTCTATGCCTTTGAGGCTTTGGATTGTTGGATATGCTTTACAGTGTTTGCTTCACATGGTTTGTGTTTGCGTTG
AGTATAGACGCCGAATTCAGCTTAGCGATTCATCTCCAATTTTGAATTCCGAGCAGAGAAACGCTGCTGGAGGTTGGAACAGTTCGAGTTCCGGA
AGTGACAGCGGTGAAACTGGTGATTATCAGTCTGAGGGGCGTCAGAATGAGGATGAAATTAGTGTAGCTAAGCATCTGGAATCTGCAAATACCAT
GTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372779] SGN-U582129 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186260 [Download][View] Facility Assigned ID: FA0AAD20DF12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5