EST details — SGN-E372801

Search information 
Request: 372801Match: SGN-E372801
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179556Clone name: TUS-32-B2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179556 is on microarray TOM1 spot ID 1-1-7.2.1.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82399 [cLET-1-M7] Trace: SGN-T102405 EST: SGN-E292131 Direction: 5' Facility: TIGR
Clone: SGN-C179556 [TUS-32-B2] Trace: SGN-T186360 EST: SGN-E372879 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372801Length: 708 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E372801 [] (trimmed) GAAATGTTGAAGCAAATGGTTCTGTGTTTGATCCTAAGCTATCATCGGAGCTGAGATTGTTACTCGAGCGGTATGCCAATATCTTGGGATTATCC
TTCCAGGATGCTGTAGGGATGGCTTTTGATATTTCGAGTGGTCTTAAGGATGCAGAGGCATGGAGCTGCAATCTGATTGATTGGATGAACTTTTT
TGTATTTTTAAATGCTTGGAATCTTTATTCTCATGAAGTAGATAGAGATTCAAATAAGCATGGTACTACATGGCTTGTGAATTTGATTCTGAAGA
AGTGTATCCTGGATAAAGTGAGATCAATGGGAGCACCAGAGTCATCACCCGGATGTGATCTTCCTCATTTGGTGCTATTGGTAACTGAACCTTTA
GCTTGGCATATTATGGTGATTCAGTGTTGTGCCAGGTCATTATTGCCTTCAGGAAAGAGAAAAAAGAAAGGTGGACCTTCGGAGCAGTGTAACAT
TGAGTTGTGTCAAGAAGTACAGGATTCAATCCGTTGTGTATGTGAGACTATAGAGCTGGTTAGAGATTGGCTAAATAAACAAATGAGCAAGTCAG
ACAATGACAAATTGGAAAGTATACTTTCATCACTCAAAAGAGATGGAGAGTTAGGACCCTGGAAGGTCTACCGCGTTATTGAAACTTTAACCTCG
TCTTCAACAATTGATAAAGGTCTTGGTGATGTGATCACTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372801] SGN-U569621 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186282 [Download][View] Facility Assigned ID: FA0AAD20DA01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5