Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E372977

Search information 
Request: 372977Match: SGN-E372977
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179615Clone name: TUS-32-D13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179615 is on microarray TOM1 spot ID 1-1-4.4.1.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80051 [cLET-11-B4] Trace: SGN-T105370 EST: SGN-E292907 Direction: 5' Facility: TIGR
Clone: SGN-C179615 [TUS-32-D13] Trace: SGN-T186131 EST: SGN-E372978 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372977Length: 609 bp (914 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372977 [] (trimmed) GGNGCACTTTTTGAGACAGAAACAGAATCCAAAGAACTCTCTCTCTAGCAGGAAAAAATGGCGTCGGATCGGAAAATTCATGCATTTGAGGAGGT
CGCTAAGCACAACAAGACCAAAGATTGCTGGCTCATCATCAGCGGAAAGGTGTATGATGTCACTCCGTTCATGGATGATCATCCAGGTGGTGATG
AAGTTTTGCTTTCAGCAACTGGGAAGGATGCAACAAATGACTTTGAAGATGTTGGCCACAGTGATTCTGCTAGAGAGATGATGGATAAGTATTAC
ATTGGGGAAATCGACATGTCAACTGTTCCCCTAAAACGTGCTTATATTCCATCAGAACAAACAGCATACAATCCAGACAAGACTCCAGAATTCAT
TATCAAAATCCTACAGTTCCTTGTACCCATCTTGATCCTGGGCTTGGCCTTTACGGTACGACACTACACCAAGGAGCAGTAATTCTTCTGAATTC
CAGTCTGTCAGGCCCTCTTTTCTTGATTTATGTAGTTGTTGAAAGAAGACTTGGTTTATCTTGTTTTAGTTCATTATCGAACTGCAACAACTGAA
TGTGGTCGCCAATTTTGGACTGTGCTTCACAATTGCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372977] SGN-U581041 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186130 [Download][View] Facility Assigned ID: FA0AAD20CB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.994 Expected Error Rate: 0.0191 Quality Trim Threshold: 12.5