EST details — SGN-E373010

Search information 
Request: 373010Match: SGN-E373010
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179767Clone name: TUS-32-J21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179767 is on microarray TOM1 spot ID 1-1-4.2.1.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80722 [cLET-13-D2] Trace: SGN-T106002 EST: SGN-E294159 Direction: 5' Facility: TIGR
Clone: SGN-C179767 [TUS-32-J21] Trace: SGN-T186164 EST: SGN-E373011 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373010Length: 672 bp (878 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373010 [] (trimmed) GCAAATAAAATAACAATTAGTACGTAATTTCTCCTTCCTTAGATGATCCCTCAAATTTATTTGCACATATATACTAGAGTTACAGTTTTATACAA
ATTATTGCAAAACCAAAATAAAACCGAAAGAGATACACAAAGAAACTAAAATCCATCGACATCTTCTCCAAAGCGACCAGGGGAGGAGCCACCTT
GAACCAAGAGGGTTCATTCGAATCCCCTTCGGCGAAAAATTATATTACTTATACATGGTTAAAATAATTTTTTATGTATATATAGTAGATGTTAA
ACCCCCTTTATCGAGTTTGAACCCTCTTCTTGAAAATTCTGATTTCGCCTCTAAAAAAAGGATTCTTTAAAACCTTGAACTCTAAAATCAAGATC
CTGGCCGGTGAGTCTAGCCTGGTTTCACTGCATCGCCGGAGCTGCTGGCTGCACTGCCTCGCTAGTTCTCTCCAATTACTGTTGCTTACTGTCGT
TGGAGATTCTGTTATTCTCCTCACCTGGCCTGGAGAAGAGAGGAGAGAGGAGAAGGTGGAAGAGCGAGGGTAAAGGGAAAGGGTCAGGCGAGAGA
GGAGAAAGAGGACGGCGTCGGACACATTTCGCCGGAGCTCGTCGTGGAGGAGAAAGAGTAGCGGCGCTGCTGCCTTCTAGAAGAAGGAGAGAGGG
AGGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373010] SGN-U575448 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186163 [Download][View] Facility Assigned ID: FA0AAD20CE11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0027 Quality Trim Threshold: 12.5