EST details — SGN-E373011

Search information 
Request: 373011Match: SGN-E373011
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179767Clone name: TUS-32-J21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179767 is on microarray TOM1 spot ID 1-1-4.2.1.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80722 [cLET-13-D2] Trace: SGN-T106002 EST: SGN-E294159 Direction: 5' Facility: TIGR
Clone: SGN-C179767 [TUS-32-J21] Trace: SGN-T186163 EST: SGN-E373010 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373011Length: 673 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373011 [] (trimmed) TGCAGCCTCCCTCTCTCCTTCTTCTAGGAGGCAGCAGCGCCGCTACTCTTTCTCCTCCACGACGAGCTCCGGCGAAATGTGTCCGACGCCGTCCT
CTTTCTCCTCTCTCGCCTGACCCTTTCCCTTTACCCTCGCTCTTCCACCTTCTCCTCTCTCCTCTCTTCTCCAGGCCAGGTGAGGAGAATAACAG
AATCTCCAACGACAGTAAGCAACAGTAATTGGAGAGAACTAGCGAGGCAGTGCAGCCAGCAGCTCCGGCGATGCAGTGAAACCAGGCTAGACTCA
CCGGCCAGGATCTTGATTTTAGAGTTCAAGGTTTTAAAGAATCCTTTTTTTAGAGGCGAAATCAGAATTTTCAAGAAGAGGGTTCAAACTCGATA
AAGGGGGTTTAACATCTACTATATATACATAAAAAATTATTTTAACCATGTATAAGTAATATAATTTTTCGCCGAAGGGGATTCGAATGAACCCT
CTTGGTTCAAGGTGGCTCCTCCCCTGGTCGCTTTGGAGAAGATGTCGATGGATTTTAGTTTCTTTGTGTATCTCTTTCGGTTTTATTTTGGTTTT
GCAATAATTTGTATAAAACTGTAACTCTAGTATATATGTGCAAATAAATTTGAGGGATCATCTAAGGAAGGAGAAATTACGTACTAATTGGTATT
TTATTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373011] SGN-U575448 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186164 [Download][View] Facility Assigned ID: FA0AAD20CE11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0028 Quality Trim Threshold: 12.5