EST details — SGN-E373038

Search information 
Request: 373038Match: SGN-E373038
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179909Clone name: TUS-32-P19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179909 is on microarray TOM1 spot ID 1-1-6.4.1.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86911 [cLET-44-L12] Trace: SGN-T111376 EST: SGN-E298740 Direction: 5' Facility: TIGR
Clone: SGN-C179909 [TUS-32-P19] Trace: SGN-T186192 EST: SGN-E373039 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373038Length: 396 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373038 [] (trimmed) GATTAAATTTGAAGATTATGTAGTCTTGGCTTTTGCATATATATGATTACATAAAAGACATGCAGTAGCTTCACAATTTTTACAGATAAAAGAGT
GTACTAAGTTCATTTTCCGGGTACAAAGTTTGTGGCGTAAGCCCAAGCATTGTTGGCAACTGGATCAGCAATGTGGTCGGAAAGGTTCTCAATTG
GACCTTTTCCAGTAACAATAGCTTGAACAAAGAAACCAAACATCGAGAACATAGCTAATCGTCCATTCTTGATTTCCTTGACCTTCAACTCAGCA
AATGCCTCCGGATCATCAGCAAGGCCCCTACTGATTCAAATTCAAGTCGTGGTTTCGGTCCGAGTGATGGCAACACTAACAAGGGCCTGCCTTCT
GGCGGTTGCAGAATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373038] SGN-U578647 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186191 [Download][View] Facility Assigned ID: FA0AAD20CH10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5