Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E373235

Search information 
Request: 373235Match: SGN-E373235
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179239Clone name: TUS-31-D21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179239 is on microarray TOM1 spot ID 1-1-4.4.2.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77143 [cLES-20-B17] Trace: SGN-T102080 EST: SGN-E290401 Direction: 5' Facility: TIGR
Clone: SGN-C179239 [TUS-31-D21] Trace: SGN-T185372 EST: SGN-E373234 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373235Length: 449 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373235 [] (trimmed) GAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGAT
ACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCA
TGGGTCCGTATCATCGGATTCGACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAACT
AATTGCCCTATGTTTATAGGGACAGTTTGTTTGAATTCTCCTTTGGGTTTTCCCTTGAGAAATTGTATTCATTTTCCCTTGTTTTCCATCTTTTT
ATTCCGTGTATGATTAATTCGAATTTCAATCAAGTTTACAAGAACTATATTAATGATATTTGTTTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373235] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185373 [Download][View] Facility Assigned ID: FA0AAD19CB11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5