Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E373340

Search information 
Request: 373340Match: SGN-E373340
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179327Clone name: TUS-31-H13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179327 is on microarray TOM1 spot ID 1-1-4.4.2.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77363 [cLES-20-L15] Trace: SGN-T102102 EST: SGN-E290423 Direction: 5' Facility: TIGR
Clone: SGN-C179327 [TUS-31-H13] Trace: SGN-T185479 EST: SGN-E373341 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373340Length: 685 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373340 [] (trimmed) AAAACAACAATCCATGTACTATATTAACATTGAATGCAACTCAAACACCACATGTACTGGAATTAACAGCTCCTTAAAAACCTATTTTACTCTGA
ATAATATGAGTAAATTGAGTCAACTGAATTTGAGCTGTACAAGTCTAGTGAGGGACCAAAGCAAGTTCATGAGTATCATTACAATTTGGAACCCT
ATTGTACACTAGCTGCAGCATCCACCTTTTTGAGCAACTGCTCCATCCCTTGGACCAGCTGGACCTTGCGTACGCCCATAACCAACCTTGATTCC
AAATGACTCGTTGGAGACATCAAAAACACCTTCTTGGATCTTTTGAAGTATCTTGGCAGCAGTCTGTATAAAGGCCTCCTCAACACTTTGAGCAG
TTCTAGCAAACGCCTCAAGAAACAAAAGCCCATTTTCTTTTGCAAATTGTTCTCCCTCCTCTTTACTGACAGCTCTTCGATGAGACAGATCACTC
TTATTTCCTACCAGCATTATAGTCATATTTGGATTTGCATGCTGCCTAGCATCTTCAAGCCAGCTGGCTAGGTGATTAAATGTCTCTCTCCTGGT
GATGTCATAAACCAAAAGTGCGCCAGCTGCTCCTCTGTAATATGACCTGGTGATGGATCTGAAAGATTCCTGCCCAGCAGTGTCCCAAATTTGAA
GTTTAATAGGCTTGCCGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373340] SGN-U573044 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185478 [Download][View] Facility Assigned ID: FA0AAD19CD07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5