Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E373348

Search information 
Request: 373348Match: SGN-E373348
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179365Clone name: TUS-31-J3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179365 is on microarray TOM1 spot ID 1-1-6.2.2.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82127 [cLET-1-A10] Trace: SGN-T102424 EST: SGN-E292150 Direction: 5' Facility: TIGR
Clone: SGN-C179365 [TUS-31-J3] Trace: SGN-T185487 EST: SGN-E373349 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373348Length: 771 bp (905 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373348 [] (trimmed) GAAAAAAAAATCCATTCTATGAAGTCACAACTACTTTACAGGGCCATCAAACAATCAAAATTCAAAAAATATATTATGATATTCATTTTCCGGGG
ACAAAGTTTGTGGCGAAAGCCCAAGCGTTGTTGTTAACGGGGTCTGCAAGGTGGTCAGCAAGGTTCTCCAATGGACCCTTTCCGGTAACAATGGC
CTGAACAAAGAATCCGAACATAGAGAACATAGCAAGTCTGCCGTTCTTAATCTCCTTTACCTTGAGCTCAGCAAATGCCTCGGGGTCTTCAGCAA
GGCCTAATGGGTCGAAGCTGCCACCGGGGTAGAGTGGGTCGACAACCTCACCAAGAGGTCCACCAGCAATACGGTAACCTTCAACGGCTCCCATC
AAGACAACTTGGCAAGCCCAGATGGCCAAGATGCTCTGTGCATGGACCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCTCCCTCGCTGAAGATCTG
GGATCCGGCCTTGAACCACACAGCCTCACCGAACTTGACACCGTTACGGGCCAATAGCTCAGGGAAGACACATCCAAGAGCACCAAGCATAGCCC
ATCTGCAGTGGATCACCTCGAGTTCACGGTTCTTGGCAAAGGTTTCAGGGTCTGCTGAGAGTCCAGCGGTATCCCAGCCGTAGTCACCAGGGAAT
TCACCAGTCAAGTAGCTTGGGGACTCACCAGAGAATGGGCCCAAGTACTTAACACGGTCAGGGCCATACCATGGACTGCTAGATGGGGCAGACCT
GGCAACAGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373348] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185486 [Download][View] Facility Assigned ID: FA0AAD19CE02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5