EST details — SGN-E373499

Search information 
Request: 373499Match: SGN-E373499
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179272Clone name: TUS-31-F6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179272 is on microarray TOM1 spot ID 1-1-3.2.2.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373499Length: 662 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E373499 [] (trimmed) CTTGTTTAGACCCTTCCTTCTTCTTCTTCTTCTTCTTCTTCTCTGCATTACATACAAGATTTTTCTCTGTTCCCCTCACATTTCTTGGAGTATCC
CCACTGACCCAGATCGGATTCTTGCAATATTTATCAAGTTTCCTGTTACCCATTTCAGATTCTGTTGGCAATTGAGAGTGACAACTTAGTAAACT
GTTTTAAGGAAAAAGAAAGGATTTTTAGTGCATAAAGATCTTATCTTTAAGTTTCTTTTGGGTAACTGAAATGCAAATCTGTTGTTAAGGACAGA
TTTCATGGGTTCTTGTTTTAGTATTGAAGAAGATGAATCAGAACCGCGACCACATAACAAGCCAGTTGGCCATGGAGTTGGTGCATATCCCAGAT
CAAATCCTGTAATTCCCCAGAATGCAAATCTTAATGCTCATGACCCCGAAAAGGCAAACAGCATTGTGGTGATTCCCAAAAATGTCAAGGACCTG
CGGCAGAATCCTGGGAGTAGCGACCTTGATATCTTCACATATGAAGAGATGAAGTTGTCTACCAAGCACTTCCGACCAGATAAGGTACTCGGAGA
GGGTGGGTTTGGCATTGTCTACAAAGGAGTTATTGATGAAAATGTCAGACCAGGATACAAGACCACATATGTTGCCATTATAGAGCTTGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373499] SGN-U583661 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185637 [Download][View] Facility Assigned ID: FA0AAD19DC03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5