EST details — SGN-E373569

Search information 
Request: 373569Match: SGN-E373569
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179920Clone name: TUS-33-A6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86922 [cLET-44-L24] Trace: SGN-T111523 EST: SGN-E298887 Direction: 5' Facility: TIGR
Clone: SGN-C179920 [TUS-33-A6] Trace: SGN-T186533 EST: SGN-E373568 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373569Length: 445 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373569 [] (trimmed) TTGAAGAATGGTGATGCTGGTATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCCGAATACCCACCATTGGGTCGTTTTGC
TGTGAGGGACATGAGGCAAACTGTTGCTGTGGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGA
AGAAGGGAAAGTAGAGTGCATTTGATGAGCACGGATGAAATAGTTTTGTTTATTTGCATCAGTTTTTTTCATTTTTGTTTTGGACAGCATTTTGC
CAGTTTTGGATATGGCTACAGAAGGTATTGTCATGGTTCTCTAGCCTCTTTTTGAGGATAGTGGAGTAATTGAGCAATTATGTCGGGACCAAATT
ACTTGATGGGCAATGACATATAGCTCTGTTGGTTGTTCCTTTACCTGGGTTAAATCACTTTACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373569] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186534 [Download][View] Facility Assigned ID: FA0AAD21BA03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5