EST details — SGN-E373590

Search information 
Request: 373590Match: SGN-E373590
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180012Clone name: TUS-33-E2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C87185 [cLET-45-J11] Trace: SGN-T111634 EST: SGN-E300462 Direction: 5' Facility: TIGR
Clone: SGN-C180012 [TUS-33-E2] Trace: SGN-T186556 EST: SGN-E373591 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373590Length: 688 bp (939 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373590 [] (trimmed) AACAAGGGGAAATAATATAGGACTAGTATACAACAGTTCAAAATTTACACTTTTGAAGATCTATCAACATAAATAAACACAACAGGACTCTTCAA
GCTGTTGTTTAGCTCATTGCATTATGAGCACAAGGGTTGGGATGTCCTATAAGGGCAGCATGCCCTGATAGAGATACAACATGTATATATATATA
TATACTACAATTATAAGGTTTCCATCACAAAACTATTGTTCATCACTCGCGTTTATGGAATTTAACCGCCTTAGTCTCTGGTCAAGCTCTGCCAT
GACCGCTGGTTCCTGCTTTTTCCTCTGTCTTGATATAGTAGTAGTAGTCATAAAACCAATTTGATCAAAAGCAACCGTCAACAAGTCATCAGGAT
CAAAAAGTTGATGTGTGCATCTCTGGATTATATGAATTACATCCCCAACATGATGCACCGTCAGCAACTCTTCTTCGTTCATTTTAAAAATTGCC
AATGCCACATGAAATAAAAGATTTGCACCTTCATTGAAAAGGACGTCCCAGACCCGCAAGGTTGTCTCAAAAGGCAAGCTTTTGGCGAAAAGGCA
GAGAAACCATTCGGTGCAAACAAGAGAAACGTCGAACTCCAGTGCCTCCAAATGAGCGGCTATCCTTGGACATTTTTTGGTTAATAGATCCTTGA
ACACTCTTTGTTCAACATGACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373590] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186555 [Download][View] Facility Assigned ID: FA0AAD21BC01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5