Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E373646

Search information 
Request: 373646Match: SGN-E373646
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180226Clone name: TUS-33-M24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106610 [cLPP-2-L22] Trace: SGN-T173757 EST: SGN-E362897 Direction: 5' Facility: TIGR
Clone: SGN-C180226 [TUS-33-M24] Trace: SGN-T186612 EST: SGN-E373647 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373646Length: 608 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373646 [] (trimmed) AATGTGTAATATTTGTTAATTTTATTAGACTTAGTCATATGATACATTGCAGAATACATATAATAGTACTATTGTTGAATGAAATAAAACGAAGA
AAATTTTATTGGTCCATAGTCTAAACATTTGAATCTGATGATGTACAAAACGAATCGGAGTTATTATTGTGCGTGATGATAGGTGCCTTGTCTGA
AACAGTCCAAACCTTTACAGATTTATCAAGACTTCCACTATAAACGACCCATTTCTGATCTGTTTCAGTGGATTCTTTATCTTCTTCTACTGCTA
GACATTTTACTGGCCCATTATGACCACTCAATACAGATAACAATGTGTGTATAGACTTCTTGTCCCTTCTCCAAACACATATTGTTTTATCAGCT
GATCCACTGAGTAGCAAATTTCCAGCTGCTGCAAGGCATAAAATAGCCAATTTGTGTCCCTTTAGCACTCCACCATGTGATAATTGCTTCTCTCG
TTCCCAGAAATTCACAACACCATCAGATGAACCACAGTATACTACTGAACCAGATTTGCTAACAACTAATGCTGTCACTGCACATTCTTGATTTA
AAAGTGTTTGAACAAATACATGTTTTGGGTGTTTCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373646] SGN-U582931 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186611 [Download][View] Facility Assigned ID: FA0AAD21BG12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5