EST details — SGN-E373691

Search information 
Request: 373691Match: SGN-E373691
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180110Clone name: TUS-33-I4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93365 [cLEX-14-H7] Trace: SGN-T118291 EST: SGN-E305805 Direction: 5' Facility: TIGR
Clone: SGN-C180110 [TUS-33-I4] Trace: SGN-T186657 EST: SGN-E373692 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373691Length: 709 bp (921 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373691 [] (trimmed) ATCAGAAAAAATAATGTATTTTTGCAAAATACAGAAATGGTTAATTTCTGAATAGTGAAAAGCTGCAACACCTTGTAATTTTTCCAAAAAGAAAC
TGCTGCCTTATGCCACCTCTCTACATAAATTCCTTTTAACCAAGCAAAATGCTTTTTCTCTCTAAACTACATATGTAGTAGGCCAACTCAGCATT
AACAGAACAATTATCTACAAAAATGTACTACTATCACTCTACAAATTTTCATATAGTCTACGATCGACATACAGAATCGAAGAAACTTGTGTCTG
TACAACTCTTACAAAAACAACAACATATCATATGATATTAAATCATTAGGAGTCTCTGTATATAGGCTGTGGTGCCCATTTGAGATGCAAGTTCA
GTTTCCCTGATTTAGCTCCATCTAGTTCAAAGGTTTCTTTATATTCACCTTCCATTAGTACTCTTGTCAATGTCAATATGCACCTTCCCATGTAA
TCCTTTCCGAAGGTGTCATGGTCCCAAACTTCTAGAATTAACATATCATGCAATCCGTCCTCAACGACAAAGTCAAAAGTCTGATTCCATACTGG
ATTTAAGCTTTCTGGTACAACCCTGGTTTTGTTCTTTGTTTCAGTCTTCTTCATTGTAACTACAACATATGGATCAGCTTTCCCCAGTAGATCAG
TAGGGGCCAAATCCTTAGCTGATATCACGGTTACAGAGAGTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373691] SGN-U585888 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186656 [Download][View] Facility Assigned ID: FA0AAD21BE02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5