EST details — SGN-E373708

Search information 
Request: 373708Match: SGN-E373708
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180178Clone name: TUS-33-K24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106444 [cLPP-2-D22] Trace: SGN-T173733 EST: SGN-E362873 Direction: 5' Facility: TIGR
Clone: SGN-C180178 [TUS-33-K24] Trace: SGN-T186672 EST: SGN-E373707 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373708Length: 711 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373708 [] (trimmed) GAAACAGAGTCATCAAAATTTGGGGAAAATTCTTACAAGAGAATCGAATAGATTTTGATTTGAGGAAAAAAAGGGGTGGTGTTGAAGTGGATTTG
TGATGGTAAGGAGTGTTTGGTTGTGAGTAAAATTCGTTTTTTCTTTTTTGGGTTTTGGGTGGTTGGAGTAAAGAGCGAAAGAGAAGGAAAATTGC
AGGTATGAATAGAGGAGGAATTGTAATTGGAGGGCCAATGCGAAAGTCTTTTAAGGACTCTCTTATAGTTCTTGAAGCTGATATTCAGCATGCTA
ATACTCTGGCATCTGACTTTCCCCGAGAGTACGATGGGGCCTGCCTACAGATGAGAATGTCCTACAGTCCAGCAGCGCACCTGTTCCTTTTCTTA
GTCCATTGGACTGATTGCCACCTTGCTGGTGCACTTGGATTGATGAGACTTCTTATTTACTAGGTTTATGTTGATGGCACCACAACCATGTCTGT
TCATGACAGGAAAGCGAGCATTACGGAGTTCTATGCTGTTATTTATCCCTCCTTACTTTAACTTGAAAGAGGTGTTACGGATTCATAAGACAAAA
AGCAAAAAGCATTATGCCAGGAGAGATACAGGAGAAGAGATGATGAGGATTACAGATCATCTGCTGACTCTGACATTGAAAGGGAAGAGGAATGT
GGAATCTGCATGGAAATGAACAGCAAAATTGTTCTTCCCAAATGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373708] SGN-U568639 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186673 [Download][View] Facility Assigned ID: FA0AAD21BF12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0184 Quality Trim Threshold: 14.5