Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E373921

Search information 
Request: 373921Match: SGN-E373921
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179971Clone name: TUS-33-C9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87065 [cLET-45-D14] Trace: SGN-T111829 EST: SGN-E300657 Direction: 5' Facility: TIGR
Clone: SGN-C179971 [TUS-33-C9] Trace: SGN-T186372 EST: SGN-E373920 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373921Length: 684 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373921 [] (trimmed) CACGTTACTCAACTTTGACTTCTGGCGTGCGTTCGGCGGAAGTTCAGAGATCGGTGAAGATGACCAAACTTCATGCTTTTAACGACTTGTTGGAG
CACAACAACAAAGATGATTGCTGGCTTCTCATCTCTGGAAAGGTTTATGATGTAACCTCTTTTTTGGATGATCATCCTGGAGGTGATGAAGTGTT
GCTAACTGCAACAGGCAAGGATGCGACAGATGATTTTGAAGATGTCGGTCACAGTGATGATGCAAGAGAGATGTTGAAGAAATACTTCATTGGTG
AAATTGACAGTTCCACCATTCCTGCAGAACGCAAACATACCCCGCCTCCCTCAGCAACACCATCAGCTGGAGGACAGGGTTCTGGAAACTCATGG
AAGCTATTGCAATTCTTGTTACCCTTGTTGATATTGGTTGCAGCCCTTGCCTTCCGTTCCTTTTACCAGAAAGAATAGATCAGCCAGTTGTCATG
TTTCAAGCTGTGACTGGATACCCTTGCAGCATGTCATTTCATATGTTGTGCTTTCCTATTCAGGTTATGTCTATTTGCTACCTTTGTTGGATGTC
CTTTACTGGTATAATGAGATATTAAGATGTTAGGTCTGTGTTGGTAATGTTGTCTTTTAAAATAAAAGTTATATGGTAAAAAACAAATGGTGTAC
TATGCAATTTGGTTCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373921] SGN-U563020 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186373 [Download][View] Facility Assigned ID: FA0AAD21AB05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0067 Quality Trim Threshold: 12.5