EST details — SGN-E373953

Search information 
Request: 373953Match: SGN-E373953
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180109Clone name: TUS-33-I3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93361 [cLEX-14-H23] Trace: SGN-T118293 EST: SGN-E305807 Direction: 5' Facility: TIGR
Clone: SGN-C180109 [TUS-33-I3] Trace: SGN-T186404 EST: SGN-E373952 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373953Length: 700 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373953 [] (trimmed) GTAAAAGTGTAGCAATTTCATATATAACTATAGTATTTGAAATGGCTTCCAATAGCTTCTTTCTTCTTCATGTTTTGGTCATGTTTTCTCTAGCA
AGCATGGCACTTTCGGATTCTCTTTCACCTTCTTTCTATAATCATGTATGTCCTGAAGCTTTGCCAGCCATAAAACGAGTCGTTGAGGATGCAGT
CAGGAAAGAGAGGCGAATGGGTGCCTCTTTGCTACGTTTACACTTTCATGATTGTTTTGTCAATGGGTGTGACGCTTCAATTCTTCTAGACAAAA
CGGCTACTATTGACAGTGAAAAGACTGCGATACCCAATAACAATTCTATTAGAGGATTTGATGTGATTGACAAAATCAAGTCAGAAGTTGATAAA
TGTTGTGGACGTTCTATTGTGTCTTGTGCAGATATTGTAGCTGTTGCAGCTCGCGACTCTGTAGTTGCACTAGGTGGACCAACATGGGAAGTTCC
TTTGGGAAGAAGGGATTCGACTACAGCAAGTAGAACCAAAGCAAACAATGATATCCCACCTCCAACTTTGGACTTACCAGCACTTATCAACAGCT
TCAAGAAGCAAGGATTGAATGAGAAAGATCTCGTCGCACTCTCTGGAGGACACACACTAGGATTTGCTCAATGTTCCACCTTCAGGAATCGTATC
TACAATGACACTAACATCGACTCCACTTTTGCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373953] SGN-U576374 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186405 [Download][View] Facility Assigned ID: FA0AAD21AE02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5