Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E374001

Search information 
Request: 374001Match: SGN-E374001
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179931Clone name: TUS-33-A17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86950 [cLET-44-N16] Trace: SGN-T111382 EST: SGN-E298746 Direction: 5' Facility: TIGR
Clone: SGN-C179931 [TUS-33-A17] Trace: SGN-T186454 EST: SGN-E374002 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374001Length: 635 bp (923 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E374001 [] (trimmed) GGAAAAAAAAATCCATTCTATGAAGTCACAACTACTTTACAGGGCCATCAAACAATCAAAATTCAAAAAATATTTTATGATTTTCATTTTCCGGG
GACAAAGTTTGGGGCGAAAGCCCAAGCGTTGTTGTTAACGGGGTCTGCAAGGGGGTCAGCAAGGTTCTCCAATGGACCCTTTCCGGTAACAATGG
CCTGAACAAAAAATCCAAACATAAAAAACATAGCAAGTCTGCCGTTCTTAATCTCCTTTACCTTGACCTCAACAAATGCCTCGGGGTCTTCAACA
AGGCCTAATGGGTCAAAGCTGCCACCGGGGTAAAGGGGGTCGACAACCTCACCAAAAGGTCCACCACCAATACGGTAACCTTCAACGGCTCCCAT
CAAAACAACTTGGCAAGCCCAAATGGCCAAAATGCTTTGTGCATGGACCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCTCCCTCGCTGAAAATCT
GGGATCCGGCCTTGAACCACACAGCCTCACCGAACTTGACACCGTTACGGGCCAATAGCTCAGGGAAAACACATCCAAAAGCACCAAGCATAGCC
CATCTGCAGTGGATCACCTCGAGTTCACGGTTCTTGGCAAAGGTTTCAGGGTCTGCTGAAAGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374001] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186453 [Download][View] Facility Assigned ID: FA0AAD21AA09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0175 Quality Trim Threshold: 14.5