EST details — SGN-E374086

Search information 
Request: 374086Match: SGN-E374086
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179953Clone name: TUS-33-B15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87008 [cLET-45-A15] Trace: SGN-T111700 EST: SGN-E300528 Direction: 5' Facility: TIGR
Clone: SGN-C179953 [TUS-33-B15] Trace: SGN-T186701 EST: SGN-E374087 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374086Length: 433 bp (920 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E374086 [] (trimmed) GAAGTAAAACAGTGGTGCTCTATCTTTTATTTAAAGAAGCAAGAAAACCACAGAAAAAAATGGAAACAAGTACTAACCATACAAATGATTGAAGA
AGAGCTGAGTAGCACCAGTAGATTTAACAACTTCAAGAAGAGAAGAAATACTATCAGTAGATCTCTTTGTAATAAGGGAGGTTCCAAGACTCTTC
AAAGATGAATCAAGATGAGCCAAACTCTGCTTAAGCCACCATCTTGAAACTCTACCAGGATAATAATGCCCTTCTTCTTCAGGAGCATAAATAAA
CACAGCAATAACTGCCCCTGCTCTAACTCCAGCAGCCAAAGCAGGGTTATCTTCCACTCTCAGATCCCTTCTAAACCATACTATGCTACAACCAC
CACCTGACATCTTCCTTCAACAACACCAAAGACTAGTCTTTTTCTCTCTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374086] SGN-U583256 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186700 [Download][View] Facility Assigned ID: FA0AAD21CA08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5