EST details — SGN-E374174

Search information 
Request: 374174Match: SGN-E374174
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179947Clone name: TUS-33-B9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86995 [cLET-44-P23] Trace: SGN-T111351 EST: SGN-E298715 Direction: 5' Facility: TIGR
Clone: SGN-C179947 [TUS-33-B9] Trace: SGN-T186787 EST: SGN-E374173 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374174Length: 483 bp (946 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374174 [] (trimmed) CTCCAACAGAGCAAGAACTGGTGTTCCTCTACCGCCTAACCTCTGGAGCATGCCCGGAGAGCTATGGGATGCAAGTAGCCCTTATGGCTGGAATA
CCGAAAACTGTGGTTGAATCTGCATTGAGTGCGGCGCAAGTAATGGAGAAAATGAACAGAGAAAGTTTTAAGTCTTCTGAACAAAGAGCTAACTT
TTCAACACTGCATGAGCAATGGTTCACGACTCTTCTGGATATCTCGAAGACGGATGGTGGACTAAATAGTGACAATGATGACGACAATGACCTAT
TTGATACATTGTTTTGTTTGTGGCATGAACTTAAGGCTGATAGATCCACTTGCTGAAAATGTTGGTCTTTTGAATAGACCATTATGCTGTAAACT
GATGATGTTTTTATTTTGGAAGAAAGGGTGTACATGTTTTATGTGGGAAAAAGGGTCGAAATGATTTATTGGTTGGCCTTATCCTCCGGTATATT
ATTTGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374174] SGN-U567784 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186788 [Download][View] Facility Assigned ID: FA0AAD21CA05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5