Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E374205

Search information 
Request: 374205Match: SGN-E374205
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180089Clone name: TUS-33-H7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93314 [cLEX-14-F19] Trace: SGN-T118112 EST: SGN-E305626 Direction: 5' Facility: TIGR
Clone: SGN-C180089 [TUS-33-H7] Trace: SGN-T186818 EST: SGN-E374204 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374205Length: 726 bp (950 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374205 [] (trimmed) GGAGATATTCAACCAGAAGCATGGACTCATCTCCGGGAATTTTCAATCTTTTGGATCAAGATGTTCAGTTTCCGGCGACAATCAGAAATCACATA
CAGCAAGCCACACCAGCTCTTGGACCACCACCGCCACGTCCCCCGCCACCTCCACCACCACCTTCTAAGAATATAGAAAGCCCCAAAACACCCTC
ACCTCGACTTTCAAAGCCAGCATTTAACCCTCCAGTTCTTGAATCTCCTTTAAAACCCATTGGAATTGAGAGTCCAGTATTGGTTTCTCCAATGG
AGTTGCCTTCTGTTTCGGAACATATTGAGAAGGATGATGAGAGAACTGAGGAACCCAAACCAAAGTTGAAAACTTTGCATTGGGATAAAGTGAGA
GCAAGTTCGGATCGCGAAATGGTTTGGGATCAACTGAAATCGAGCTCATTTAAGTTGAATGAAGAGATGATAGAAACACTCTTTGTTGTAAAGAC
TCCTACATTGAATGCAAACGACACAACTAGACGTCTAGTACCCTCACCGAGCCAAGAGAATAGGGTACTTGATCCAAAGAAAGCACAAAACATCG
CAATTTTGCTGAGGGCCATAAATGTAACCACAGAGGAAATATGTGAAGCCCTTTTAGAAGGAAATGCTGAAACTATTGGGAGTGAGCTCCTTGAG
ATTTTATTGAAGATGGCTCCATCAAAAGAGGAAGAACGTAAGCTAAAAGATACAAAGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374205] SGN-U576757 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186819 [Download][View] Facility Assigned ID: FA0AAD21CD04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5