EST details — SGN-E374277

Search information 
Request: 374277Match: SGN-E374277
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180048Clone name: TUS-33-F14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87279 [cLET-45-N21] Trace: SGN-T111818 EST: SGN-E300646 Direction: 5' Facility: TIGR
Clone: SGN-C180048 [TUS-33-F14] Trace: SGN-T186892 EST: SGN-E374278 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374277Length: 653 bp (933 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E374277 [] (trimmed) CATTTACAAATAGTCCACTAAGCTCTCTGAACGAACAAAACAAAAAAACTTAAAATGATACTTTATTTCGACCTCCCAATATCGTTTATTTTGTC
TCGCATAAATTTACATAAACCCAATAGCTTTAATATCTATCTAACATATCAATAAATATTTGACGGGGAATACAATTTTATTATATTTTGGATCT
CCCTGTTCTTCACATAAGGGAACAATTCGATTGACCATAAAAATCTGTAACTTGGTAAACAGGGTATTGATAAGGCGGATAAACATAGTAATACA
AGTCGGGCTGCGATTGTACCACCGCAGTTGCAGCTGCAGCCGGAGCTGGAGCTGGAGCTGCGGGTTTTTTATCGCCACCAGCCGGGCCAACGCTA
ACCAAGTCCGCCTGGCCCAAATTCTTCCTCAATAAGCTCGTTAAAGTCGCAGCGTCTACTTCTCCCACAACTTCGAGTTGATTCTTTCCGTCTCC
TGTTATAGCTGCTGATTCTACGCCTGATTGAAAAACAGCAATTTTGAAGGCCTTGGTTCGATCTTTCTGACCGTTTCCATTTAAAGATAGTCTAA
TAACAACCTTTTGCTTCATTTTGATTGTTTGTTTGCTGGGGAATTAAATTTTTGGTTAGGAGTAAAGAATATTTGAAATGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374277] SGN-U584433 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186891 [Download][View] Facility Assigned ID: FA0AAD21DC07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0134 Quality Trim Threshold: 12.5