EST details — SGN-E374583

Search information 
Request: 374583Match: SGN-E374583
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173233Clone name: TUS-15-J15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173233 is on microarray TOM1 spot ID 1-1-2.2.20.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1900 [cLEC-14-D6] Trace: SGN-T26495 EST: SGN-E204879 Direction: 5' Facility: TIGR
Clone: SGN-C173233 [TUS-15-J15] Trace: SGN-T188814 EST: SGN-E374584 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374583Length: 739 bp (931 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E374583 [] (trimmed) ATATAAAAAACTAACTTTAACTTTTATACACTTATAACGTGAACAAAAGATTTACAATATGGATAATTATAACAATGTAATGAAAAACTAGACTA
CACATGCATAATGCATACACCTCCAAGGCCCTCTAAAAAGATCTTTTTTTTTTTTACTCAGTACTAAGTTATACTCTACAAGAGAGCAAATAGAT
CGAGTTAATAAATAACAAGTCGTCATTGGGTATGATTCTTGAAATAGTCAAGACGACTATCAGCCAGACGTAATGAATACACAATTTGTTTAAAG
TCCCCCCACTTGAAAGGCTTATAAATATTAGTAATATTGTTGATTTGAGGAGGAGCACTTATCCAAGCGCCAAGAGCAGGAGCTGCAAAGTACAT
CATGGACATTCTACTTTTCCATGAATTTATTGACACCACTCTATGTCTTACACTGGTAAATCTACCATTCGTCAACGCCTGAAAGGAGTCCCCTA
CGAAAACGAAGAACTCATTAGGATCAGGAGGAACAGGTATCCAAAATCCATCATGAGTATATATTTGAAGTCCACTAACGTCATTTGATCGAAGG
ATTGTTAGTATTTGTGGATCAGTATGTTCTCCAAATCCAACTCTTGATTTTGATGGATTTGGTGATAGGCCCCAATGATTATTGTTTAGTTCATC
TTGATTATCATCATTATTAGGTGTGATAAATGGTGGATAGTGATTGACTCTGAAACAAGAGTCATTGTGTGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374583] SGN-U568917 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188813 [Download][View] Facility Assigned ID: FA0AAD3CE08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5