EST details — SGN-E375822

Search information 
Request: 375822Match: SGN-E375822
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173310Clone name: TUS-15-M20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173310 is on microarray TOM1 spot ID 1-1-5.1.19.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2039 [cLEC-14-K15] Trace: SGN-T26226 EST: SGN-E204610 Direction: 5' Facility: TIGR
Clone: SGN-C173310 [TUS-15-M20] Trace: SGN-T188677 EST: SGN-E375823 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375822Length: 559 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375822 [] (trimmed) CCAAAAGGCAACAAAGCTTAACAACAAAAATTTATTTTATGTCATATGGTATAACATGATTTACTATAGCATATAGTAAAAATCTATTTGATTTT
CTGCAAATTTACAACCAAGGAGAGTTGTAGATAGGAGTGGCTACAGATTTAACTTGAAGATACTTATGAAGTCCTTCCATTCCCAAATCTCTTTC
AAAGCCACTGCATTTGTATCCTCCATATGGACAATCCGGATCGAAAGCAAAGTAACAGTTTATCCAGATTACACCAGCTCGAATCGATCTTGAAA
CTGTGTTAGCAATGTTCAAGTTATTGGTCATCACACCTGCTGCTAATCCATAGTTTGTACAGTTAGCTCTCTTGATCACCTCCTCTACCGTCTTA
AACTTCATTACTGCCAGAACAGGTCCAAATATTTCTTCTTTTGCAATTTTCATGTCATCTTCAACATCAATAAATATAGTTGGCTCAATGAAATA
ACCCTTTCTATCCAATGCATTGCCCCCAGTTAGCAGTTTCGCACCCTCCCTCTTGCCATGTTCAATGTACGAAAGTACTCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375822] SGN-U572155 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188676 [Download][View] Facility Assigned ID: FA0AAD3BG10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0074 Quality Trim Threshold: 20.5