EST details — SGN-E376734

Search information 
Request: 376734Match: SGN-E376734
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174896Clone name: TUS-19-O22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174896 is on microarray TOM1 spot ID 1-1-3.3.15.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23720 [cLED-6-C3] Trace: SGN-T50204 EST: SGN-E233218 Direction: 5' Facility: TIGR
Clone: SGN-C174896 [TUS-19-O22] Trace: SGN-T189347 EST: SGN-E376733 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376734Length: 640 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376734 [] (trimmed) AAATTGAATCTTTTCAGTGAACTTTTACTATTTGGTCAATCAAGAAGTGAAATTACAGAGCAAAAGCAGATATAGTTTTGAAGATGGCAGGTTAC
AGAGGTGATGATGAGTATGATTACCTTTTCAAGCTTGTGTTGATAGGTGATTCAGGTGTGGGTAAATCTAATCTGCTTTCCAGGTTCACCAAAAA
TGAATTCAATTTGGAGTCTAAATCAACTATTGGGGTTGAATTTGCAACCAAAAGTCTTAATATTGATGGTAAAGTTATTAAAGCTCATATTTGGG
ATACTGCTGGTCAAGAAAGGTATCGTGCCATTACGAGTGCTTATTATCGGGGAGCTGTCGGTGCTTTGCTCGTATATGATGTTACTCGACATGTT
ACCTTTGAAAACGTCAACAGGTGGTTGAAGGAATTGAGAGACCATACTGACCCTAACATTGTAGTCATGCTCCTAGGCAACAAATCAGATCTCCG
ACATCTCGTGGCTGTTTCAACTGAAGAGGCTAAATCTTTGGCAGAGAGGGAAGCCCTAATACTTCATGGAAACTTCTGCATTAGAAGCGACCAAC
GTGAAAATGCGTTTACTGAAGCTTTCACGCAGATATACCGGATCGTCAGTAAGAAAGCAGTCGAGGAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376734] SGN-U564990 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189348 [Download][View] Facility Assigned ID: FA0AAD7BH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5